Thoracic Cancer
John Wiley & Sons Australia, Ltd
image
microRNA‐100 functions as a tumor suppressor in non‐small cell lung cancer via regulating epithelial‐mesenchymal transition and Wnt/β‐catenin by targeting HOXA1
Volume: 11 , Issue: 6
Doi: 10.1111/1759-7714.13459
  • PDF   
  • XML   
  •       

Table of Contents

Highlights

Notes

Abstract

BackgroundNon‐small cell lung cancer (NSCLC) is a leading subtype in lung cancer, with high morbidities and mortalities worldwide. microRNA (miRNA) has appeared to play indispensable roles in a variety of solid carcinomas. The current study focused on the functions of miR‐100 in NSCLC.MethodsqRT‐PCR was performed to detect miR‐100 and HOXA1 expressions in NSCLC tissues and cells. MTT and transwell assays were used to determine the functions of miR‐100 in NSCLC cell proliferation, invasion and migration abilities. Western blot was used to measure related protein expressions.ResultsqRT‐PCR results showed that miR‐100 expressions were dramatically decreased in NSCLC tissues. MTT assays indicated that miR‐100 restoration inhibited NSCLC cell proliferation. Furthermore, transwell assay was performed to determine the impacts of miR‐100 on NSCLC invasion and migration abilities. As expected, the invasion and migration capacities were significantly repressed. Direct interactions between HOXA1 and miR‐100 were also verified via dual‐luciferase reporter assays. Western blot analysis demonstrated that miR‐100 exerted suppressive functions via regulating EMT and Wnt/β‐catenin in NSCLC cells.ConclusionsOur results showed that miR‐100 served antitumor roles in NSCLC, providing new evidence of miR‐100 as a promising therapeutic biomarker in NSCLC.

Keywords
Han, Ren, Yang, Li, Zhao, and Lin: microRNA‐100 functions as a tumor suppressor in non‐small cell lung cancer via regulating epithelial‐mesenchymal transition and Wnt/β‐catenin by targeting HOXA1

Introduction

Non‐small cell lung cancer (NSCLC) remains one of the major factors for tumor‐associated deaths globally despite significant advances in surgical treatments and drug development.1 However, due to the high rate of drug resistance, metastases and relapses, the prognosis of NSCLC is still poor.2 The frequent relapse and poor outcome in NSCLC patients highlight the imperative need to develop early biomarkers and novel screening strategies for the accurate detection of metastases and recurrence.3, 4 Therefore, it is essential to fully understand the tumorigenesis mechanisms of NSCLC and to develop new therapeutic approaches for NSCLC patients. Epithelial‐mesenchymal transition (EMT) is considered as a crucial step in malignancy progression, in which progress the epithelial cells are conversed into mesenchymal cells in cell morphology.5 EMT has been reported to exert pivotal functions in tumor progression, including metastases.6 Wnt/β‐catenin signaling pathway is also implicated in development of multiple tumors.7 The Wnt/β‐catenin is frequently aberrantly activated in human cancers, including gastric cancer,8 osteosarcoma9 and hepatocellular carcinoma.10 Therefore, the mechanism underlying EMT and Wnt/β‐catenin signaling pathway in NSCLC are the focus of the current study.

The dysfunctions of microRNAs (miRNAs) have been identified as key regulators of various biological processes in numerous carcinomas.11, 12 miRNAs may modulate the expressions of different coding genes by inducing translational repression or the degradation of target mRNAs via base pairing with the specific sequences in the 3′UTRs.13 In fact, the deregulations of many carcinogenic or antitumor miRNA have been verified to be associated with tumor initiation and progression.14, 15 For example, miR‐133b/135a induced human renal carcinoma cell apoptosis via the JAK2/STAT3 signaling pathway16; miR‐21 promoted triple‐negative breast cancer cell proliferation and invasion via targeting PTEN17; and miR‐4317 suppressed human gastric cancer cell proliferation via the regulation of ZNF322.18 However, the exact mechanism by which miR‐100 exerts its functions in NSCLC progression is not well elucidated.

Homeobox (HOX) genes often present different expression patterns during development, and changes in the expressions have been related to a variety of diseases, including neoplasia.19 HOX are implicated in development through modulating cell angiogenesis, migration, survival and differentiation.20 Homeobox A1 (HOXA1) is one of the important members of the HOX family and overexpression of HOXA1 has been confirmed in various cancers, which is associated with tumor development and poor prognosis.21 Some studies have demonstrated that HOXA1 plays vital roles in tumorigenesis. For instance, miR‐99a suppressed nasopharyngeal carcinoma cell metastases and invasion via regulation of HOXA1.22 Another study indicated that HOXA1 promoted prostate cancer cell progression.23Additionally, overexpressed HOXA1 in oral squamous cell carcinomas was confirmed to be correlated with poor prognosis.24 However, the exact functions of HOXA1 in NSCLC are not well understood.

Methods

Patients and tumor samples

A total of 52 pairs of NSCLC tissue samples and adjacent normal tissue samples were obtained from NSCLC patients who underwent surgical resections at The Affiliated Hospital of Qingdao University from September 2015 to November 2017, without having prior chemotherapy or radiation therapy. All tissue samples were instantly ice‐covered in liquid nitrogen and stockpiled at −80°C. Informed consent was obtained from all participants. All tissue specimens were obtained with approval of the Medical Ethics Committee of The Affiliated Hospital of Qingdao University.

Cell lines

Human normal bronchial epithelium cell BEAS‐2B and NSCLC cells (NCI‐H460, NCI‐H1299, SPC‐A1 and A549) were purchased from ATCC and maintained in DMEM (Gibco; Thermo Fisher Scientifc, Inc., Waltham, MA, USA) which contained 10% FBS (Gibco; Thermo Fisher Scientifc, Inc.) in a humidified atmosphere with 5% CO2 at 37°C.

Cell transfections

miR‐100 mimics, inhibitor as well as the corresponding negative controls were obtained from GenePharma (Shanghai, China). Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) was applied for miRNA transfections in accordance with the manufacturer's instructions.

qRT‐PCR

TRIzol reagent (Invitrogen) was applied to extract the total RNAs from the tissues or cells in line with the manufacturer's proposals. After that, the PrimeScript reverse transcription reagent kit (Thermo Fisher Scientific) was utilized for cDNA syntheses. Quantitative RT‐PCR was performed using SYBR Premix Ex Taq II (Takara, Dalian, China) with the 7500 real‐time RT‐PCR system (Applied Biosystems, Foster City). The 2‐ΔΔCt method was used to calculate expression levels. U6 and GAPDH served as internal controls for miR‐100 and HOXA1, respectively. The primer sequences are listed in Table 1.

Table 1
Primer sequences for qRT‐PCR
PrimerSequence
miR‐100 forward5′‐ GCGGCAACCCGTAGATCCGAA‐3'
miR‐100 reverse5′‐ GTGCAGGGTCCGAGGT‐3'
U6 forward5′‐CTCGCTTCGGCAGCACA‐3'
U6 reverse5′‐ AACGCTTCACGAATTTGCGT‐3'
HOXA1 forward5′‐ ‐CGGCTTCCTGTGCTAAGTCT ‐3'
HOXA1 reverse5′‐ TAGCCCAGCCAAATACACGG ‐3'
GAPDH forward5′‐ACCTGACCTGCCGTCTAGAA‐3'
GAPDH reverse5′‐TCCACCACCCTGTTGCTGTA‐3'
U6: small nuclear RNA, snRNA.
HOXA1, homeobox A1; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase.

MTT assays

MTT assays were employed to determine the impacts of miR‐100 on NSCLC cell proliferation ability. In brief, transfected NSCLC cells were plated into 96‐well plates and incubated for indicated times (0, 24, 48 and 72 hours). Then, MTT (5 mg/mL) solution was appended into each well and incubated for another 4 hours. After that, the culture medium was removed and DMSO was added to dissolve the MTT‐formazan crystals. The absorbance values were determined using a microplate reader (BioTek, Winooski, VT, USA) at 490 nm.

Transwell assays

Transwell assay was conducted to determine the functions of miR‐100 overexpression or knockdown in NSCLC cell invasion and migration using 8 μm pore sized transwell chamber (BD Biosciences, San Jose, CA, USA) coated with or without Matrigel. Transfected NSCLC cells in serum‐free medium were plated into the top chambers. In the meantime, medium containing 10% FBS was placed into the bottom chamber as a chemoattractant. Following incubation at 37°C in a 5% CO2 atmosphere for 48 hours, cells which had not invaded or migrated through the membrane were wiped with a cotton swab, whereas cells which had adhered to the undersurface of the membrane were fixed with methanol and stained with crystal violet. Invasion or migration capacities were then quantified by counting five independent visual fields under the microscope (Olympus).

Western blot

Total cellular proteins were isolated using RIPA buffer (Thermo Scientific) and quantified with a BCA Protein Assay Kit (Pierce, Rockford, IL, USA). Protein lysate was then separated by 10% SDS‐PAGE, followed by transfer onto PVDF membrane (Invitrogen). After blocking with 5% skim milk in TBST at room temperature for 2 hours, the membrane was incubated at 4°C overnight with specific primary antibodies: HOXA1 (1:1000, Abcam), cyclin D1 (1:1000, Abcam), c‐Myc (1:1000, Abcam), β‐catenin(1:1000, Abcam), p‐GSK3β (1:1000, Abcam), E‐cadherin (1:2000, Abcam), N‐cadherin(1:2000, Abcam), Vimentin (1:1000, Abcam) and GAPDH (1:1000, Abcam). After washing with TBST, the membrane was incubated with HRP‐labeled secondary antibody (1:3000, Abcam) at room temperature for 2 hours. GAPDH was used as an internal control. Finally, the bands for proteins were visualized using ECL western blot detection reagents (Beyotime).

Luciferase activity assay

The full‐length 3′‐UTR of HOXA1 with miR‐100‐5p binding sites were inserted into the downstream of firefly luciferase gene of the pGL3 promoter vector (Invitrogen; Thermo Fisher Scientific, Inc.) by Genepharma (Shanghai, China) to construct the wild‐type (WT) or mutant (MUT) HOXA1 3′‐UTR for luciferase reporter experiments. NSCLC cells were cotransfected with miR‐100 mimics and WT or MUT HOXA1‐3′UTR using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). After 48 hours, cells were collected and analyzed with the dual‐luciferase reporter assay system (Promega) following the manufacturer's instructions.

Xenograft mouse model

All animal assays were approved by the Research Ethics Committee of The Affiliated Hospital of Qingdao University. A549 cells stably transfected with miR‐100 (lenti‐miR‐100) or a control (lenti‐control) were injected subcutaneously into nude mice (4–6 weeks old). Tumor growths were monitored every three days via measuring tumor volumes with the following formula: tumor volume = 1/2 × (length × width2).

Statistical analysis

All data in the current study were derived from at least three independent experiments. SPSS software version 17.0 (SPSS Inc., Chicago, IL) was used to perform statistical analysis. Multiple comparisons were conducted using ANOVA followed by Scheffe's post‐hoc analysis, whereas comparisons between the two groups were performed using Student's t‐test. Kaplan‐Meier method and log‐rank test were applied to estimate the survival rates and compare the survival curves, respectively. P < 0.05 indicated statistically significant differences.

Results

miR‐100 was expressed at low levels in NSCLC and correlated with poor prognosis

To explore the functions of miR‐100 in NSCLC, we first measured miR‐100 expression levels in NSCLC tissues. qRT‐PCR analysis demonstrated that miR‐100 expressions were prominently downregulated in NSCLC tissues (Fig 1a). According to the mean level of miR‐100, the NSCLC patients were assigned into low and high miR‐100 groups. Results showed that low miR‐100 in NSCLC tissues were associated with the malignant clinicopathologic characteristics. Statistical analysis of the clinicopathologic data indicated that miR‐100 expression in NSCLC tissues was significantly related to lymph node metastasis (P = 0.0026) and tumor TNM stage (P = 0.0030). However, there was no association between its expression and patient age, gender, tumor size, histologic type, or smoking (P  > 0.05; Table 2). Moreover, Kaplan‐Meier analysis indicated that NSCLC patients in the low miR‐100 group had a significantly poor overall survival (OS) compared with those in the high miR‐100 group (Fig 1b)

miR‐100 was downregulated in NSCLC tissues and associated with a poor prognosis of NSCLC patients. (a) miR‐100 expressions in NSCLC tissues were detected using qRT‐PCR. (b) Kaplan‐Meier analysis of different miR‐100 expressions in NSCLC patients. **P < 0.01 ( miR‐100(+) and  miR‐100(‐)).
Figure 1
miR‐100 was downregulated in NSCLC tissues and associated with a poor prognosis of NSCLC patients. (a) miR‐100 expressions in NSCLC tissues were detected using qRT‐PCR. (b) Kaplan‐Meier analysis of different miR‐100 expressions in NSCLC patients. **P < 0.01 (
miR‐100(+) and
miR‐100(‐)).
Table 2
Correlation of miR‐100 expression with the clinicopathological characteristics of the NSCLC patients
Clinicopathological featuresCases (n = 52)miR‐100 expressionP‐value
High (n = 21)Low (n = 31)
Age (years)0.3363
>60301317
≤6022814
Gender0.3612
Male281018
Female241113
Tumor size (cm)0.1534
≥ 5.024618
< 5.0281513
Lymph node metastasis0.0026*
Yes23185
No29326
Histology0.2867
Squamous cell carcinoma261214
Adenocarcinoma26917
TNM stage0.0030*
I + II24168
III + IV28523
Smoker0.4056
Yes291316
No23815
* Statistically significant.
The mean expression level of miR‐100 was used as the cutoff.
NSCLC, non‐small cell lung cancer; TNM, tumor‐node‐metastasis.

miR‐100 upregulation suppressed NSCLC proliferation

To confirm the above findings, we next detected the miR‐100 expressions in NSCLC cells. As expected, we found that miR‐100 expressions in all NSCLC cells were significantly downregulated when compared to the normal cells (Fig 2a). miR‐100 gain‐function and loss‐function assays were performed to determine the biological functions of miR‐100 in A549 or SPC‐A1 cells, according to their endogenous low and high miR‐100 expressions. The efficiency of transfections were confirmed using qRT‐PCR (Fig 2b,c). Subsequently, MTT assays showed that miR‐100 overexpression dramatically repressed NSCLC cell proliferation ability, whereas miR‐100 inhibitor had the opposite effect (Fig 2d,e).

miR‐100 inhibited NSCLC cell proliferation. (a) qRT‐PCR was used to measure miR‐100 expressions in NSCLC cells. (b, c) miR‐100 overexpression or inhibition was confirmed by qRT‐PCR. (d, e) MTT assays were performed to detect the functions of miR‐100 in NSCLC cell proliferation. *P < 0.05, **P < 0.01, ***P < 0.001 (d:  NC and  miR‐100 mimics; e:  NC and  miR‐100 inhibitor).
Figure 2
miR‐100 inhibited NSCLC cell proliferation. (a) qRT‐PCR was used to measure miR‐100 expressions in NSCLC cells. (b, c) miR‐100 overexpression or inhibition was confirmed by qRT‐PCR. (d, e) MTT assays were performed to detect the functions of miR‐100 in NSCLC cell proliferation. *P < 0.05, **P < 0.01, ***P < 0.001 (d:
NC and
miR‐100 mimics; e:
NC and
miR‐100 inhibitor).

miR‐100 overexpression suppressed NSCLC cell invasion and migration

Transwell assay was then performed to determine the impacts on NSCLC invasion and migration. Data revealed that miR‐100 restoration significantly suppressed A549 cell invasion and migration capacities (Fig 3a,b). In contrast, we found that miR‐100 knockdown promoted SPC‐A1 cell invasion and migration in comparison with the control group (Fig 3c,d). All these findings implied that miR‐100 exerted antitumor functions in NSCLC.

miR‐100 suppressed the cell invasion and migration abilities of NSCLC cells. (a, b) The impacts of miR‐100 restoration on NSCLC cell invasion and migration were determined using transwell assays. (c, d) Transwell assay was performed to determine invasion and migration capacities of miR‐100 suppressed NSCLC cells. **P < 0.01, ***P < 0.001.
Figure 3
miR‐100 suppressed the cell invasion and migration abilities of NSCLC cells. (a, b) The impacts of miR‐100 restoration on NSCLC cell invasion and migration were determined using transwell assays. (c, d) Transwell assay was performed to determine invasion and migration capacities of miR‐100 suppressed NSCLC cells. **P < 0.01, ***P < 0.001.

HOXA1 was an important target formiR‐100

To further explore the downstream regulatory mechanism of miR‐100 in NSCLC, we next explored potential targets of miR‐100. According to Targetscan, HOXA1 was an important target of miR‐100, and potential miR‐100 target sequences in the HOXA1 3′UTRs were identified (Fig 4a). We then performed dual‐luciferase reporter analysis to confirm the association between HOXA1 and miR‐100. As shown in Fig 4b, miR‐100 mimics prominently decreased the luciferase activity in the HOXA1‐3′UTR‐WT group, whereas the relative luciferase activity in the HOXA1‐3′UTR‐MUT group exhibited no notable changes in cells treated with miR‐100 mimics. To further confirm the regulatory roles of miR‐100 in HOXA1 expression, we measured HOXA1 expressions in A549 and SPC‐A1 cells transfected with miR‐100 mimics or inhibitor. We found that miR‐100 overexpression was able to suppress HOXA1 expressions, whereas miR‐100 inhibition had the opposite effects in NSCLC cells (Fig 4c,d).

HOXA1 was a direct target of miR‐100 in NSCLC cells. (a)The WT and MUT binding sites of miR‐100 on HOXA1 3′‐UTR. (b) Dual‐luciferase reporter assay was used to confirm the association between miR‐100 and HOXA1 in NSCLC cells ( NC and  miR‐100 mimics). (c, d) Regulatory effects of miR‐100 on HOXA1 expressions in NSCLC cells. *P < 0.05, **P < 0.01.
Figure 4
HOXA1 was a direct target of miR‐100 in NSCLC cells. (a)The WT and MUT binding sites of miR‐100 on HOXA1 3′‐UTR. (b) Dual‐luciferase reporter assay was used to confirm the association between miR‐100 and HOXA1 in NSCLC cells (
NC and
miR‐100 mimics). (c, d) Regulatory effects of miR‐100 on HOXA1 expressions in NSCLC cells. *P < 0.05, **P < 0.01.

miR‐100 regulated EMT and Wnt/β‐catenin in NSCLC cells

As HOXA1 was identified as a direct target for miR‐100 in NSCLC cells, we then determined the clinical value of HOXA1 in NSCLC. First, the expressions of HOXA1 in NSCLC tissues cells were detected using qRT‐PCR and the results demonstrated that HOXA1 expressions were significantly upregulated in NSCLC tissues and cells (Fig 5a,b). Thereafter, a negative correlation between miR‐100 and HOXA1 expressions in NSCLC tissues was identified (Fig 5c). Moreover, Kaplan‐Meier analysis was applied to examine the prognostic values of HOXA1 in NSCLC patients. We found that NSCLC patients with high HOXA1 expressions had shorter overall survival (OS) than those with low HOXA1 expressions (Fig 5d). Western blot was then conducted to determine the potential mechanisms underlying the functions of miR‐100 in NSCLC. Results on the impact of miR‐100 on Wnt/β‐catenin in NSCLC cells indicated that the expressions of cyclin D1, c‐Myc, activated β‐catenin and p‐GSK3β were significantly reduced by miR‐100 overexpression (Fig 5e). We subsequently detected the EMT‐related markers E‐cadherin, N‐cadherin and vimentin for evaluating the effects of miR‐100 on EMT cell process. It was found that miR‐100 overexpression enhanced the E‐cadherin expressions, whereas it decreased the N‐cadherin and vimentin expressions (Fig 5e).

miR‐100 regulated NSCLC EMT and Wnt/β‐catenin. (a, b) qRT‐PCR assays were performed to detect the expressions of HOXA1 in NSCLC tissues and cells. (c) A negative correlation between miR‐100 and HOXA1 expressions in NSCLC tissues was identified. (d) Survival curves of NSCLC patients with low and high HOXA1 expressions ( HOXA1(‐) and  HOXA1(+)). (e) Western blots were applied to determine the functions of miR‐100 in NSCLC EMT and Wnt/β‐catenin pathway. *P < 0.05, **P < 0.01,***P < 0.001.
Figure 5
miR‐100 regulated NSCLC EMT and Wnt/β‐catenin. (a, b) qRT‐PCR assays were performed to detect the expressions of HOXA1 in NSCLC tissues and cells. (c) A negative correlation between miR‐100 and HOXA1 expressions in NSCLC tissues was identified. (d) Survival curves of NSCLC patients with low and high HOXA1 expressions (
HOXA1(‐) and
HOXA1(+)). (e) Western blots were applied to determine the functions of miR‐100 in NSCLC EMT and Wnt/β‐catenin pathway. *P < 0.05, **P < 0.01,***P < 0.001.

miR‐100 overexpression suppressed NSCLC tumor growth in vivo

In vivo xenograft assays were performed to observe the effect of miR‐100 on NSCLC growth. It was found that miR‐100 overexpression remarkably restrained the growth of A549 xenograft tumors and the tumor growth rate in the lenti‐miR‐100 group was significantly lower than those in the control group (Fig 6a,b). These results indicated that overexpression of miR‐100 could suppress the tumor sizes and growth rates of NSCLC.

miR‐100 inhibited NSCLC tumorigenesis in vivo. (a) Growth curve of tumor volumes in different groups ( lenti‐miR‐100 and  lenti‐control). (b) Representative images of tumors in different groups. **P < 0.01, ***P < 0.001.
Figure 6
miR‐100 inhibited NSCLC tumorigenesis in vivo. (a) Growth curve of tumor volumes in different groups (
lenti‐miR‐100 and
lenti‐control). (b) Representative images of tumors in different groups. **P < 0.01, ***P < 0.001.

Discussion

NSCLC is one of the most malignant tumors and is usually diagnosed at advanced stages, leading to poor survival.25 During NSCLC tumorigenesis, a variety of epigenetic and genetic alternations typically occur. Moreover, despite advances in novel diagnostic and surgical approaches, the survival rates of NSCLC remain unsatisfactory, and new therapeutic biomarkers have yet to be explored.26 Therefore, in order to seek more effective treatment strategies, contemporary studies pay attention to the molecular mechanism involved in the genetic or epigenetic process of NSCLC.27 Recent tumor research has proved that miRNA is able to regulate various biological processes such as apoptosis, proliferation and metastases.28, 29, 30 Previous studies have elucidated that the alterations of miRNA expressions could influence NSCLC tumorigenesis. Many upregulated miRNAs such as miR‐1269a, miR‐146, and miR‐378 have been reported to promote NSCLC cells.31, 32, 33 In contrast, some downregulated miRNAs such as miR‐148a, miR‐200c, and miR‐204 have been reported to repress NSCLC development.34, 35, 36 Thorough understanding of the association between abnormally expressed miRNAs and NSCLC development may therefore help to identify novel diagnostic and therapeutic biomarkers for the treatment of NSCLC.

miR‐100 has been identified in various human cancers. In the study by Luan et al . overexpression of miR‐100 was found to inhibit human glioblastoma cell chemosensitivity, proliferation and migration through FGFR3.37 miR‐100 inhibited nasopharyngeal carcinoma cell invasion and migration by regulating IGF1R in the report by Sun et al .38 In NSCLC, previous studies showed that miR‐100 overexpression inhibited NSCLC development, including growth, migration and chemosensitivity, via directly targeting FGFR3.39 In addition, miR‐100 functioned as a poor prognostic factor for NSCLC patients and miR‐100 overexpression could lead to growth inhibition, G2/M cell cycle arrest and apoptosis enhancement in NSCLC cells by post‐transcriptionally regulating PLK1 expression.40 According to another study, low expression level of miR‐100 in NSCLC patients was found to be closely associated with poor prognosis of patients.41 All these studies demonstrated the importance of miR‐100 in NSCLC via regulation of different target genes. Based on the above research, we further investigated the functions and potential mechanisms of miR‐100 in the regulation of the progression of NSCLC via regulating other targets. In this study, miR‐100 was frequently downregulated in NSCLC tissues and relevant with the malignant phenotypes of NSCLC patients. Moreover, miR‐100 overexpression was able to suppress NSCLC cell proliferation, invasion and migration capacities via modulating EMT and Wnt/β‐catenin. Additionally, in vivo xenograft assays also demonstrated that miR‐100 significantly suppressed NSCLC growth.

Increasing studies have shown that HOXA1 could influence different cellular processes including apoptosis, proliferation, and EMT, and overexpression of HOXA1 is sufficient to cause malignant transformations of nontumorigenic epithelial cells.42 A study by Zhang et al . showed that HOXA1 upregulation enhanced NSCLC tumorigenesis and progression.43 In particular, a previous study showed that downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR‐100.44 However, the correlation between miR‐100 and HOXA1 in NSCLC remain unclear. Herein, we found that HOXA1 was upregulated in NSCLC tissues and indicated a poor prognosis in NSCLC patients. Furthermore, we identified that HOXA1 was a candidate target of miR‐100 in NSCLC cells. We demonstrated that the functional effects of miR‐100 in NSCLC were regulated by HOXA1.

In conclusion, our findings indicated that the downregulated miR‐100 in NSCLC was associated with poor prognosis and adverse phenotypes in NSCLC patients. The functional assays indicated that upregulation of miR‐100 prominently suppressed NSCLC cell proliferation, invasion and migration via the repression of HOXA1, as well as the regulation of EMT and Wnt/β‐catenin. These results may be helpful to better understand NSCLC pathogenesis and provide beneficial clues for the diagnosis and treatment of NSCLC.

Disclosure

The authors declare that there are no conflicts of interest.

References

1 

    TorreLA, BrayF, SiegelRL, FerlayJ, Lortet‐TieulentJ, JemalA. . Global cancer statistics, 2012. CA Cancer J Clin2015; 65: , pp.87–108.

2 

    WoodSL, PernemalmM, CrosbiePA, WhettonAD. . The role of the tumor‐microenvironment in lung cancer‐metastasis and its relationship to potential therapeutic targets. Cancer Treat Rev2014; 40: , pp.558–66.

3 

    JoshiP, JeonYJ, LaganaAet al. MicroRNA‐148a reduces tumorigenesis and increases TRAIL‐induced apoptosis in NSCLC. Proc Natl Acad Sci U S A2015; 112: , pp.8650–5.

4 

    WuH, ZhouJ, MeiSet al. Circulating exosomal microRNA‐96 promotes cell proliferation, migration and drug resistance by targeting LMO7. J Cell Mol Med2017; 21: , pp.1228–36.

5 

    ShuangZY, WuWC, XuJet al. Transforming growth factor‐beta1‐induced epithelial‐mesenchymal transition generates ALDH‐positive cells with stem cell properties in cholangiocarcinoma. Cancer Lett2014; 354: , pp.320–8.

6 

    da SilvaSD, MorandGB, AlobaidFAet al. Epithelial‐mesenchymal transition (EMT) markers have prognostic impact in multiple primary oral squamous cell carcinoma. Clin Exp Metastasis2015; 32: , pp.55–63.

7 

    ZhouFQ, QiYM, XuH, WangQY, GaoXS, GuoHG. . Expression of EpCAM and Wnt/ beta‐catenin in human colon cancer. Genet Mol Res2015; 14: , pp.4485–94.

8 

    ZhaoYX, LiuJF, SunWJ, ZengRF, LiT, MaRM. . Long non‐coding RNA‐ENST00000434223 suppresses tumor progression in gastric cancer cells through the Wnt/beta‐catenin signaling pathway. Int J Biol Macromol2018; 120: 491–501.

9 

    ZhaoX, SunS, XuJ, LuoY, XinY, WangY. . MicroRNA‐152 inhibits cell proliferation of osteosarcoma by directly targeting Wnt/beta‐catenin signaling pathway in a DKK1‐dependent manner. Oncol Rep2018; 40: , pp.767–74.

10 

    YinX, YiH, WangL, WuW, WuX, YuL. . R‐spondin 2 promotes proliferation and migration via the Wnt/beta‐catenin pathway in human hepatocellular carcinoma. Oncol Lett2017; 14: , pp.1757–65.

11 

    RavidY, FormanskiM, SmithY, ReichR, DavidsonB. . Uterine leiomyosarcoma and endometrial stromal sarcoma have unique miRNA signatures. Gynecol Oncol2016; 140: , pp.512–7.

12 

    ZhaoX, HeW, LiJet al. MiRNA‐125b inhibits proliferation and migration by targeting SphK1 in bladder cancer. Am J Transl Res2015; 7: , pp.2346–54.

13 

    ChengY, XiangG, MengY, DongR. . MiRNA‐183‐5p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting the PDCD4. Reprod Biol2016; 16: , pp.225–33.

14 

    FengC, SunP, HuJet al. miRNA‐556‐3p promotes human bladder cancer proliferation, migration and invasion by negatively regulating DAB2IP expression. Int J Oncol2017; 50: , pp.2101–12.

15 

    ZhangY, AnJ, LvW, LouT, LiuY, KangW. . miRNA‐129‐5p suppresses cell proliferation and invasion in lung cancer by targeting microspherule protein 1, E‐cadherin and vimentin. Oncol Lett2016; 12: , pp.5163–9.

16 

    ZhouW, BiX, GaoG, SunL. . miRNA‐133b and miRNA‐135a induce apoptosis via the JAK2/STAT3 signaling pathway in human renal carcinoma cells. Biomed Pharmacother2016; 84: , pp.722–9.

17 

    FangH, XieJ, ZhangM, ZhaoZ, WanY, YaoY. . miRNA‐21 promotes proliferation and invasion of triple‐negative breast cancer cells through targeting PTEN. Am J Transl Res2017; 9: , pp.953–61.

18 

    HuX, ZhangM, MiaoJ, WangX, HuangC. . miRNA‐4317 suppresses human gastric cancer cell proliferation by targeting ZNF322. Cell Biol Int2018; 42: , pp.923–30.

19 

    ChenH, SukumarS. . Role of homeobox genes in normal mammary gland development and breast tumorigenesis. J Mammary Gland Biol Neoplasia2003; 8: , pp.159–75.

20 

    ShahN, SukumarS. . The Hox genes and their roles in oncogenesis. Nat Rev Cancer2010; 10: , pp.361–71.

21 

    ZhaTZ, HuBS, YuHF, TanYF, ZhangY, ZhangK. . Overexpression of HOXA1 correlates with poor prognosis in patients with hepatocellular carcinoma. Tumour Biol2012; 33: , pp.2125–34.

22 

    WangJG, TangWP, LiaoMC, LiuYP, AiXH. . MiR‐99a suppresses cell invasion and metastasis in nasopharyngeal carcinoma through targeting HOXA1. Onco Targets Ther2017; 10: , pp.753–61.

23 

    WangH, LiuG, ShenDet al. HOXA1 enhances the cell proliferation, invasion and metastasis of prostate cancer cells. Oncol Rep2015; 34: , pp.1203–10.

24 

    BituCC, DestroMF, CarreraMet al. HOXA1 is overexpressed in oral squamous cell carcinomas and its expression is correlated with poor prognosis. BMC Cancer2012; 12: , pp.146.

25 

    ZhuJ, ZhangY, YangX, JinL. . Clinical significance and tumor‐suppressive function of miR‐516b in nonsmall cell lung cancer. Cancer Biother Radiopharm2017; 32: , pp.115–23.

26 

    BaerC, ClausR, PlassC. . Genome‐wide epigenetic regulation of miRNAs in cancer. Cancer Res2013; 73: , pp.473–7.

27 

    XieY, ToddNW, LiuZet al. Altered miRNA expression in sputum for diagnosis of non‐small cell lung cancer. Lung Cancer2010; 67: , pp.170–6.

28 

    LiC, XuB, MiuX, DengZ, LiaoH, HaoL. . Inhibition of miRNA‐21 attenuates the proliferation and metastasis of human osteosarcoma by upregulating PTEN. Exp Ther Med2018; 15: , pp.1036–40.

29 

    LiP, XuT, ZhouXet al. Downregulation of miRNA‐141 in breast cancer cells is associated with cell migration and invasion: Involvement of ANP32E targeting. Cancer Med2017; 6: , pp.662–72.

30 

    LuK, ShenH, ZhuS, BiS, WuS. . Effects of miRNA‐130a on the proliferation and apoptosis of glioma cell lines. Oncol Lett2018; 16: , pp.2478–82.

31 

    JiKX, CuiF, QuDet al. MiR‐378 promotes the cell proliferation of non‐small cell lung cancer by inhibiting FOXG1. Eur Rev Med Pharmacol Sci2018; 22: , pp.1011–9.

32 

    JinRH, YuDJ, ZhongM. . MiR‐1269a acts as an onco‐miRNA in non‐small cell lung cancer via down‐regulating SOX6. Eur Rev Med Pharmacol Sci2018; 22: , pp.4888–97.

33 

    LiJ, YangH, LiYet al. microRNA‐146 up‐regulation predicts the prognosis of non‐small cell lung cancer by miRNA in situ hybridization. Exp Mol Pathol2014; 96: , pp.195–9.

34 

    ChenY, MinL, RenCet al. miRNA‐148a serves as a prognostic factor and suppresses migration and invasion through Wnt1 in non‐small cell lung cancer. PLOS One2017; 12: e0171751.

35 

    LiJ, TanQ, YanMet al. miRNA‐200c inhibits invasion and metastasis of human non‐small cell lung cancer by directly targeting ubiquitin specific peptidase 25. Mol Cancer2014; 13: , pp.166.

36 

    ZhangS, GaoL, ThakurAet al. miRNA‐204 suppresses human non‐small cell lung cancer by targeting ATF2. Tumour Biol2016; 37: , pp.11177–86.

37 

    LuanY, ZhangS, ZuoL, ZhouL. . Overexpression of miR‐100 inhibits cell proliferation, migration, and chemosensitivity in human glioblastoma through FGFR3. Onco Targets Ther2015; 8: , pp.3391–400.

38 

    SunX, LiuX, WangY, YangS, ChenY, YuanT. . miR‐100 inhibits the migration and invasion of nasopharyngeal carcinoma by targeting IGF1R. Oncol Lett2018; 15: , pp.8333–8.

39 

    LuoJ, ChenB, JiXX, ZhouSW, ZhengD. . Overexpression of miR‐100 inhibits cancer growth, migration, and chemosensitivity in human NSCLC cells through fibroblast growth factor receptor 3. Tumour Biol2015; 37: 15517–24.

40 

    LiuJ, LuKH, LiuZL, SunM, DeW, WangZX. . MicroRNA‐100 is a potential molecular marker of non‐small cell lung cancer and functions as a tumor suppressor by targeting polo‐like kinase 1. BMC Cancer2012; 12: , pp.519.

41 

    MaX, ZhouJ, MoH, YingY. . Association of miR‐100 expression with clinicopathological features and prognosis of patients with lung cancer. Oncol Lett2019; 18: , pp.1318–22.

42 

    ZhangX, EmeraldBS, MukhinaSet al. HOXA1 is required for E‐cadherin‐dependent anchorage‐independent survival of human mammary carcinoma cells. J Biol Chem2006; 281: , pp.6471–81.

43 

    ZhangY, LiXJ, HeRQet al. Upregulation of HOXA1 promotes tumorigenesis and development of nonsmall cell lung cancer: A comprehensive investigation based on reverse transcription‐quantitative polymerase chain reaction and bioinformatics analysis. Int J Oncol2018; 53: , pp.73–86.

44 

    XiaoF, BaiY, ChenZet al. Downregulation of HOXA1 gene affects small cell lung cancer cell survival and chemoresistance under the regulation of miR‐100. Eur J Cancer2014; 50: , pp.1541–54.
https://test.researchpad.co/tools/openurl?pubtype=article&doi=10.1111/1759-7714.13459&title= microRNA‐100 functions as a tumor suppressor in non‐small cell lung cancer via regulating epithelial‐mesenchymal transition and Wnt/β‐catenin by targeting HOXA1 &author=Weizhong Han,Xiaoxia Ren,Yupeng Yang,Haixia Li,Lin Zhao,Zhaoxia Lin,&keyword=Epithelial‐mesenchymal transition,HOXA1,miR‐100,non‐small cell lung cancer,Wnt/β‐catenin,&subject=Original Article,Original Articles,